Propozycja radykalnych zmian w procesie zatwierdzania leków

Rozwój leków jest procesem, w którym tworzone są nowe terapie i wprowadzane na rynek w celu leczenia chorób. Trudno sobie wyobrazić, że taka działalność nie byłaby powszechnie podziwiana i chwalona, ale ostatnio firmy farmaceutyczne, które opracowują nowe leki, były krytykowane przez pacjentów, ustawodawców i prasę1. Ta krytyka skupia się na wysokich kosztach recepty. narkotyków i rozbieżności między kosztami tych leków w Stanach Zjednoczonych i innych rozwiniętych krajach, takich jak Kanada i Wielka Brytania1. Oprócz obaw związanych z kosztami, nowszą kwestią jest utrata zaufania opinii publicznej do integralności przemysł i jego zdolność do dostarczania bezpiecznych i skutecznych leków. Read more „Propozycja radykalnych zmian w procesie zatwierdzania leków”

Zależność między przewidywaniami opartymi na ekspresji genów w przypadku raka piersi ad

Zastosowano profile oparte na ekspresji genu, model 70-genowy dobry w stosunku do złego opracowany przez van de Vijver i in. i van t Veer i wsp., 2,3 model odpowiedzi na rany opracowany przez Chang i wsp., 4,5 model rekurencyjno-punktowy opracowany przez Paika i wsp., 6 model samoistny podtypu (światło A, światło lumina- B, bazowy, HER2-dodatni i negatywny pod względem receptora estrogenowego [HER2 + i ER-] i prawidłowy piersiopodobny) opracowany przez Perou i współpracowników, 1,9,12,13 i model z dwoma genami ( stosunek poziomów ekspresji homeoboxu 13 [HOXB13] i receptora interleukiny 17B [IL17BR]) .7 (Prognozy dla każdego modelu przedstawiono w Dodatkowym dodatku.) Modele punktacji nawrotu i dwa-genowe były pierwotnie zaprojektowane w celu przewidywania wyników u pacjentów z chorobą ER +, którzy otrzymywali tamoksyfen. 6. Przeprowadziliśmy zatem oddzielne analizy dla podgrupy próbek ER + i dla całego zestawu próbek ER + i ER- łącznie. Szczegółowy opis sposobu zastosowania tych metod do zestawu danych próby 295 znajduje się w dodatkowym dodatku. Read more „Zależność między przewidywaniami opartymi na ekspresji genów w przypadku raka piersi ad”

Wysoka dawka Atorwastatyny po udarze lub przejściowym ataku niedokrwiennym

Statyny zmniejszają częstość udarów u pacjentów ze zwiększonym ryzykiem choroby sercowo-naczyniowej; czy należy zmniejszyć ryzyko wystąpienia udaru po niedawnym udarze lub przejściowym ataku niedokrwiennym (TIA). Metody
My losowo przydzieliliśmy 4731 pacjentom, którzy mieli udar lub TIA w ciągu jednego do sześciu miesięcy przed rozpoczęciem badania, mieli cholesterol o niskiej gęstości lipoprotein (LDL) od 100 do 190 mg na decylitr (2,6 do 4,9 mmol na litr), i nie mieli znaną chorobą wieńcową do podwójnie ślepej próby z 80 mg atorwastatyny na dobę lub placebo. Pierwszorzędowym punktem końcowym był pierwszy niekrytyczny lub śmiertelny udar.
Wyniki
Średni poziom cholesterolu LDL podczas badania wynosił 73 mg na decylitr (1,9 mmol na litr) wśród pacjentów otrzymujących atorwastatynę i 129 mg na decylitr (3,3 mmol na litr) wśród pacjentów otrzymujących placebo. Podczas medianowej obserwacji 4,9 roku, 265 pacjentów (11,2 procent) otrzymujących atorwastatynę i 311 pacjentów (13,1 procent) otrzymujących placebo miało zgon o charakterze śmiertelnym lub niekrytycznym (5-letnia bezwzględna redukcja ryzyka, 2,2 procent, skorygowany współczynnik ryzyka 0,84 95-procentowy przedział ufności, 0,71 do 0,99, P = 0,03, nieskorygowany P = 0,05). Read more „Wysoka dawka Atorwastatyny po udarze lub przejściowym ataku niedokrwiennym”

Nowozakażeniowa wielosystemowa choroba zapalna reagująca na hamowanie interleukiny-1 ad

Pacjenci zi bez mutacji CIAS1 mają podobne fenotypy choroby.5 Mutacje CIAS1 początkowo identyfikowano w dwóch fenotypowo łagodniejszych zespołach rodzinnych, 7 rodzinnych zimnych zaburzeniach zapalnych2 i zespole Muckle-Wellsa.2 Oba zaburzenia charakteryzują się epizodami pokrzywkowej wysypki i ogólnoustrojowego stanu zapalnego. ale nie przerost kości, przewlekłe zapalenie opon mózgowych lub upośledzenie umysłowe. CIAS1 koduje kriopirynę (znaną również jako NALP3), 8, która należy do grupy oddziałujących białek, które tworzą kompleks makromolekularny nazywany inflamasomem . 8 Zespół inflammasomu prowadzi do aktywacji kaspazy 1, która rozszczepia pro-interleukinę-1. w jej forma bioaktywna (ryc. Read more „Nowozakażeniowa wielosystemowa choroba zapalna reagująca na hamowanie interleukiny-1 ad”

Rola zmniejszonego hamowania produkcji glukozy i zmniejszone wczesne uwalnianie insuliny w upośledzonej tolerancji glukozy czesc 4

Korelacje stężenia 2-godzinnej insuliny z osoczem i 30-minutowej odpowiedzi na insulinę w osoczu z 2-godzinnym stężeniem glukozy w osoczu krwi u badanych. Symbole stałe reprezentują osoby z upośledzoną tolerancją glukozy i otwarte symbole normalnych przedmiotów. Kwadraty przedstawiają osoby otyłe i zakreślają osoby nieobeznane. Jak pokazano na rycinie 2, chociaż 2-godzinne stężenia insuliny w tętnicy były dodatnio skorelowane z 2-godzinnymi stężeniami glukozy w tętnicy (r = 0,52, P <0,01), stężenia insuliny we krwi po 30 minutach były ujemnie i silniej skorelowane z 2-godzinnym tętnicze stężenia glukozy (r = -0,75, P <0,0001). Tak więc im niższa początkowa odpowiedź insulinowa, tym większa nietolerancja glukozy. Read more „Rola zmniejszonego hamowania produkcji glukozy i zmniejszone wczesne uwalnianie insuliny w upośledzonej tolerancji glukozy czesc 4”

Rozpoznanie raka nosogardzieli przez DNA Amplifikacja tkanki uzyskanej przez aspirację drobnych igieł cd

Po amplifikacji, 10.1 mg produktu PCR rozdzielono elektroforetycznie na 2% żelach agarozowych zawierających wstępnie trawione markery wielkości lambda (Pharmacia) zawierające 0,5 .g bromku etydium na mililitr. Żele nanoszono na membrany nylonowe i sondowano je za pomocą następujących wewnętrznych sond reporterowych15, które znakowano końcowo fosforem -32: 5 GCTTTATCTGCCGCCATCAT3 dla EBNA-2, 5 TAGCCAGGAGAGCTCTTAAA3 dla EBNA-1 i 5 GACCTGGCTGGCCCGGACCTGACTGACTAC3 dla .. -actin. Wyniki
Rysunek 1. Rysunek 1. Read more „Rozpoznanie raka nosogardzieli przez DNA Amplifikacja tkanki uzyskanej przez aspirację drobnych igieł cd”

Rozpoznanie raka nosogardzieli przez DNA Amplifikacja tkanki uzyskanej przez aspirację drobnych igieł ad

Świeże węzły chłonne uzyskano podczas profilaktycznego cięcia szyi u 10 pacjentów z różnymi guzami głowy i szyi i potwierdzono, że są wolne od choroby na podstawie analizy histopatologicznej. Próbki poddawano lizie przez sześć godzin w 56 ° C w buforze do lizy A (10 mmol TRIS-kwas solny na litr [pH 8,0], mmol EDTA na litr, 0,1% dodecylosiarczan sodu [obj./obj.] I 100 .g. proteinazy K na mililitr). Próbki następnie ogrzewano w 90 ° C przez 10 minut i poddano ekstrakcji fenolem-chloroformem; 0,05 do 0,5 .g DNA zastosowano do PCR. Przygotowanie tkanek stałych
Dla każdej reakcji amplifikacji przygotowywano pojedynczy cienki przekrój (o grubości 3 .m) każdego bloku parafinowego przerzutów do węzłów chłonnych. Read more „Rozpoznanie raka nosogardzieli przez DNA Amplifikacja tkanki uzyskanej przez aspirację drobnych igieł ad”

Porównanie angioplastyki z terapią medyczną w leczeniu choroby naczyń wieńcowych o pojedynczych naczyniach ad 7

Sukces i bezpieczeństwo naszych procedur są porównywalne z danymi z rejestru PTCA National Heart, Lung i Blood Institute z 1985 r. Do 1986 r., W którym dwie lub więcej zmian rozszerzono u 22 procent 839 pacjentów poddanych PTCA z powodu choroby pojedynczego naczynia, początkowy współczynnik sukcesu angiograficznego wynosił 87 procent, kliniczny wskaźnik sukcesu wynosił 84 procent, chirurgia bypassu w trybie nagłym była wymagana w 3,5 procentach, a śmierć w 0,2 procent.21, 22 Wyniki angiograficzne zostały ocenione przez personel lokalny, który brał udział w rejestrze, podczas gdy nasze wyniki zostały oparte na pomiarach suwmiarki wykonanej przez ślepych obserwatorów w centralnym laboratorium. Obecnie PTCA jest stosowana bardziej agresywnie w chorobach wielonaczyniowych niż podczas naszego badania, w leczeniu wszystkich zmian chorobowych lub zmian winowajca , jak również w stanach klinicznych, takich jak trwająca niestabilna dławica piersiowa i ostry zawał serca.21, 23 24 25 26 Nasze wyniki nie mogą być ekstrapolowane na takie sytuacje. Wyniki dla pacjentów w naszym badaniu, którzy byli leczeni za pomocą terapii lekowej lub PTCA są podobne do wyników pacjentów leczonych za pomocą terapii lekowej lub chirurgii w randomizowanym badaniu z użyciem tętnic wieńcowych (CASS) .27 Część pacjentów leczonych PTCA w naszym badaniu badanie wolne od dławicy zwiększyło się z 9% na linii podstawowej do 64% po sześciu miesiącach; w badaniu CASS w porównaniu z grupą leczoną operacyjnie z chorobą jednonaczyniową wzrost wynosił od 20% pacjentów bez dławicy w linii podstawowej do 55% w ciągu jednego roku. Prawie dwa razy więcej pacjentów leczonych medycznie nie chorowało na dławicę w naszym badaniu po sześciu miesiącach (46 procent) jak w CASS na rok (25 procent). Read more „Porównanie angioplastyki z terapią medyczną w leczeniu choroby naczyń wieńcowych o pojedynczych naczyniach ad 7”

Krwotok płucny u pacjenta z włóknistym kłębuszkowym zapaleniem nerek

FIBRILLARY kłębuszkowe zapalenie nerek jest niezwykłą chorobą nerek charakteryzującą się naciekiem mezangium i błony podstawnej kłębuszków przez złogi fibrylarne, które są negatywne w barwieniu czerwienią Kongo, ale są reaktywne w stosunku do immunoglobulin poliklonalnych.1 2 3 4 5 Uważa się, że zaburzenie jest mediowane przez lokalną wytwarzanie lub odkładanie nieprawidłowych paraprotein. 6, 7 W około 50 przypadkach tego zaburzenia, które zostały wcześniej zgłoszone, nie było przypadków płucnych lub innych objawów pozanerkowych. Opisujemy pacjenta z fibrylarnym kłębuszkowym zapaleniem nerek, który zmarł z powodu krwotoku płucnego i zwłóknienia. Odkrycie złogów włóknistych w śródmiąższu płuc u tego pacjenta sugeruje, że niektórzy pacjenci z tym zespołem mogą mieć czynnik krążenia odpowiedzialny za odkładanie się materiału włóknistego.
Opis przypadku
68-letnia kobieta, paląca całe życie, została przyjęta do oceny pogorszenia duszności i lewostronnego zapalenia opłucnej o kilka dni. Read more „Krwotok płucny u pacjenta z włóknistym kłębuszkowym zapaleniem nerek”

Nadużycia i zaniedbania

Czy można to wywnioskować z artykułu autorstwa Localio i in. (Wydanie z 25 lipca) * że w 3570 przypadkach nadużyć popełnionych w 1984 roku w Nowym Jorku zidentyfikowano tylko 280 pacjentów, którzy mieli zdarzenia niepożądane spowodowane przez zaniedbanie medyczne. W przypadku innych roszczeń dotyczących nadużyć 3290, czy nie zostały one odkryte podczas przeglądania dokumentacji szpitala, czy nie były powiązane z wydarzeniami, które miały miejsce w szpitalu.
Allen H. Holt, MD
32 Jefferson Ave., Sharon, PA 1646
Odniesienie * Localio AR, Lawthers AG, Brennan TA, et al. Read more „Nadużycia i zaniedbania”