Rozpoznanie raka nosogardzieli przez DNA Amplifikacja tkanki uzyskanej przez aspirację drobnych igieł cd

Po amplifikacji, 10.1 mg produktu PCR rozdzielono elektroforetycznie na 2% żelach agarozowych zawierających wstępnie trawione markery wielkości lambda (Pharmacia) zawierające 0,5 .g bromku etydium na mililitr. Żele nanoszono na membrany nylonowe i sondowano je za pomocą następujących wewnętrznych sond reporterowych15, które znakowano końcowo fosforem -32: 5 GCTTTATCTGCCGCCATCAT3 dla EBNA-2, 5 TAGCCAGGAGAGCTCTTAAA3 dla EBNA-1 i 5 GACCTGGCTGGCCCGGACCTGACTGACTAC3 dla .. -actin. Wyniki
Rysunek 1. Rysunek 1. Wrażliwość systemu wykrywania EBV. Lizaty B95-8 (limfoblasty wytwarzające przeciwciała EBV) amplifikowano za pomocą standardowej PCR z parami starterów specyficznych dla genów wirusa EBNA-1 lub EBNA-2. Próbki produktu amplifikacji hybrydyzowano z wewnętrzną sondą reporterową; oba wykrywają pojedyncze komórki, które są pozytywne dla genomu EBV.
Lizaty komórek B95-8 (1 do 10 .l, 103 do 105 komórek na mililitr) amplifikowano za pomocą pary starterów EBNA-1 lub EBNA-2, a wytworzony produkt PCR oddzielono i sondowano (Fig. 1). Fragmenty amplifikacji PCR o prawidłowej wielkości hybrydyzowały z sondami reporterowymi w szerokim zakresie stężeń matrycy. Lizat od do 10 komórek B95-8 konsekwentnie generował wykrywalny sygnał hybrydyzacji. Zostało to uznane za wystarczające do analizy próbek uzyskanych za pomocą aspiracji cienkoigłowej i materiału o cienkich przekrojach dostępnych w tym badaniu. Nie zaobserwowano hybrydyzacji w reakcjach, w których użyto sondy .-aktyny i amplifikacji lizatów komórek LS180, kontroli negatywnych, nigdy nie wygenerowano sekwencji EBV (dane nie przedstawione).
Figura 2. Figura 2. Koamplifowanie regionów genowych EBNA (wirusy) i .-aktyny (człowieka) w 13 próbkach przerzutów do szyjki macicy otrzymanych przez aspirację drobnych igieł, lizaty linii 2D5 przekształconej przez EBV i EBV -Negatywna linia komórkowa LS180. Produkty amplifikacji kolejno hybrydyzowano z wskazanymi sondami reporterowymi EBNA i .-aktyny. Dwie próbki zawierały niewystarczające DNA do analizy (tj. Nie było amplifikacji .-aktyny); tylko próbka raka nosogardzieli z pierwotnego miejsca zawierała genomy EBV.
Wydajność komórek z aspiracji cienkoigłowej różni się znacznie od zera – puste igły – które występują w około 10 procentach przypadków, do 5 do 10 000 komórek, wydajność zapewniona przez trójwymiarowe fragmenty tkanki. Konieczne było włączenie kontroli amplifikacji dla każdej próbki uzyskanej przez aspirację cienkoigłową (tj. Parą starterów, która amplifikuje ludzką sekwencję genu, .-aktynę), aby wskazać, czy liczba komórek była wystarczająca do przeprowadzenia procedury. Startery do amplifikacji .-aktyny użyto razem ze starterami EBV do koamplifikacji (Fig. 2) lub reakcje amplifikacji dla obu genów przeprowadzono w oddzielnych porcjach wzorca i uzyskano podobne wyniki.
Figura 3. Figura 3. Amplifikacja fragmentów genu EBV w komórkach 2D5 i w próbkach uzyskanych przez aspirację drobnych igieł od dwóch pacjentów z przerzutami do komórek szyjki macicy od nieznanych pierwotnych nowotworów. Obie próbki przerzutowej tkanki zawierały genomy EBV. U tych dwóch pacjentów rozwinęła się postać raka nosogardzieli, 7 i 11 miesięcy po aspiracji cienkoigłowej
[hasła pokrewne: mallak gniezno, jeanine ulotka, adam dawidziuk twitter ]