Rozpoznanie raka nosogardzieli przez DNA Amplifikacja tkanki uzyskanej przez aspirację drobnych igieł ad

Świeże węzły chłonne uzyskano podczas profilaktycznego cięcia szyi u 10 pacjentów z różnymi guzami głowy i szyi i potwierdzono, że są wolne od choroby na podstawie analizy histopatologicznej. Próbki poddawano lizie przez sześć godzin w 56 ° C w buforze do lizy A (10 mmol TRIS-kwas solny na litr [pH 8,0], mmol EDTA na litr, 0,1% dodecylosiarczan sodu [obj./obj.] I 100 .g. proteinazy K na mililitr). Próbki następnie ogrzewano w 90 ° C przez 10 minut i poddano ekstrakcji fenolem-chloroformem; 0,05 do 0,5 .g DNA zastosowano do PCR. Przygotowanie tkanek stałych
Dla każdej reakcji amplifikacji przygotowywano pojedynczy cienki przekrój (o grubości 3 .m) każdego bloku parafinowego przerzutów do węzłów chłonnych. Każda sekcja została pocięta świeżym ostrzem, aby uniknąć zanieczyszczenia krzyżowego, odparafinowana 400 .l ksylenu, ponownie uwodniona w malejących stężeniach alkoholu, osuszona i rozpuszczona w 500 .l buforu do lizy B, składającego się z x buforu do PCR (Perkin-Elmer Cetus, Mississauga, Ont.) (1 x PCR składa się z 10 mm kwasu TRIS-chlorowodorowego na litr [pH 8,3], 50 mmol chlorku potasu na litr i 1,5 mmol chlorku magnezu na litr), 0,5 procent Tween 20, 0,5 procent Nonidet-P40 i 100 .g proteinazy K na mililitr (Pharmacia, Montreal). Po całonocnej inkubacji w 56 ° C, próbki ogrzewano w 90 ° C przez 10 minut i wirowano przez 5 minut przy 15000 x g, i 10 ul lizatu (2 procent całkowitej objętości) zamplifikowano za pomocą PCR.
Drobiazgowa aspiracja
Próbki tkanek od 15 pacjentów z przerzutami komórek płaskonabłonkowych do węzłów szyjki macicy (ze znanych guzów pierwotnych w 13 przypadkach i od nieznanych guzów pierwotnych w 2 przypadkach) uzyskano standardowymi technikami za pomocą igły o rozmiarze 21.14 W badaniu histopatologicznym zastosowano dwa aspiraty. diagnozę, a dwie łączono w 500 .l buforu do lizy C (1 x bufor PCR, 0,45% Nonidet-P40, 0,45% Tween 20 i 100 .g proteinazy K na mililitr), trawiono przez 4 godziny w 56 ° C, i gotowane przez 10 minut; 2 procent całkowitej objętości wykorzystano do PCR. Podobne lizaty komórek 2D5 – transformowana EBV ludzka linia komórek B opracowana w naszym laboratorium – (odpowiednik około 100 komórek) lub komórkach B95-8 została wykorzystana jako szablony pozytywne względem genomu EBV, a komórki LS180, ludzka linia komórkowa , zostały użyte jako szablony kontrolne ujemne względem EBV
PCR
Przygotowano pary primerów, które zamplifikowały niepolimorficzny jądrowy antygen jądrowy EBV (EBNA-1) (5 GTAGAAGGCCATTTTTCCAC3 i 5 CTCCATCGTCAAAGCTGCA3 ), polimorficzny gen EBNA-2 obecny tylko w szczepie A EBV (5 CAGGTACATGCCAACAACCTT3 i 5 GGTGGTGGTGGGGGGGTGG3 ) i ludzką sekwencję genomową .-aktyny 16 17 18 (5 ATCATGTTTGAGACCTTCAA3 i 5 CATCTCTTGCTCGAAGTCCA3 ). Odpowiednie pary starterów (0,1 .g), szablony testowe lub kontrolne, polimeraza Taq (2,5 U, Pharmacia, Montreal) i trifosforan dezoksynukleozydu (200 .mol na każdy litr, Perkin-Elmer Cetus) amplifikowano w 100 .l standardowego buforu do PCR z programowalnym reaktorem cyklicznym Ericomp (Ericomp, San Diego, CA) przez 30 cykli, w tym przez denaturację przez 45 sekund w temperaturze 94 ° C, wyżarzanie startera przez 30 sekund w 5 ° C poniżej temperatury topnienia i wydłużanie łańcucha przez 45 sekund w 72 ° C. DO
[więcej w: kozlek lekarski, centrum witek łomianki, mallak gniezno ]