PIC-647

Zależność między przewidywaniami opartymi na ekspresji genów w przypadku raka piersi ad 5

Profile opracowano jednak w celu przewidywania przeżycia bez przerzutów odległych tylko u pacjentów z chorobą wyłącznie z węzłem i są one przeznaczone do przewidywania rokowania bez leczenia adiuwantowego (progesteronu 70-genu) lub z użyciem tamoksyfenu ( wskaźnik nawrotów). Analiza guzów pozytywnych względem receptora estrogenowego
Rycina 2. Rycina 2. Szacowanie przeżywalności Kaplan-Meier z przeżycia wolnego od nawrotów i całkowitego przeżycia wśród 225 pacjentów z chorobą ER +, według podtypu wewnętrznego (panele A i B), wynik nawrotu (...

Więcej »

Rozpoznanie raka nosogardzieli przez DNA Amplifikacja tkanki uzyskanej przez aspirację drobnych igieł cd

Po amplifikacji, 10.1 mg produktu PCR rozdzielono elektroforetycznie na 2% żelach agarozowych zawierających wstępnie trawione markery wielkości lambda (Pharmacia) zawierające 0,5 .g bromku etydium na mililitr. Żele nanoszono na membrany nylonowe i sondowano je za pomocą następujących wewnętrznych sond reporterowych15, które znakowano końcowo fosforem -32: 5 GCTTTATCTGCCGCCATCAT3 dla EBNA-2, 5 TAGCCAGGAGAGCTCTTAAA3 dla EBNA-1 i 5 GACCTGGCTGGCCCGGACCTGACTGACTAC3 dla .. -actin. Wyniki
Rysunek 1. Rysunek 1. Wrażliwość systemu wykrywania EBV....

Więcej »

Leczenie martwiczego zapalenia jelit

Badanie Moss i wsp. (Wydanie 25 maja) jest imponujące, ponieważ reprezentuje udane, wieloośrodkowe, prospektywne, randomizowane badania kliniczne do badania martwiczego zapalenia jelit. Jednak 60 procent badanej kohorty nie miało oznak pneumatozy w badaniu radiograficznym, 77 procent ważyło mniej niż 1000 g przy urodzeniu, 30 procent nie otrzymywało żywienia dojelitowego przed wystąpieniem perforacji, a ponad 30 procent miało perforację w ciągu pierwszych dwóch tygodni po urodzeniu. Te cechy sugerują diagnozę spontanicznej perforacji jelitowej zamiast martwi...

Więcej »

Choroby układu wątrobowo-żółciowego

Poza USA i Kanadą należy dodać opłatę pocztową w wysokości 4,50 USD (1,75 USD na opłatę za mikrofilm). Obowiązuje opłata za fakturę w wysokości 15 USD za wszystkie zamówienia wypełnione przed dokonaniem płatności. Wyniki
Indeks Przedmioty
Wśród 34 osób z indeksu, z których wynikało przeciążenie żelazem, było 6 kobiet i 28 mężczyzn, z których wszyscy zgłosili konsumpcję tradycyjnego piwa. Charakterystykę kliniczną 26 osób, które przeżyły, gdy odwiedzono ich wioski, przedstawiono w tabeli 1, pogrupowano według metody selekc...

Więcej »
751#echokardiogram , #obrzezany co to znaczy , #stanozolol cena , #uzależnienie od tramalu , #sen w śnie sennik , #samoobrona dla dzieci , #żelazo poniżej normy , #kiliszek , #gdzie jest schowek w komputerze , #pęknięty jajnik ,