tatiana szymborska

Rozpoznanie raka nosogardzieli przez DNA Amplifikacja tkanki uzyskanej przez aspirację drobnych igieł cd

Po amplifikacji, 10.1 mg produktu PCR rozdzielono elektroforetycznie na 2% żelach agarozowych zawierających wstępnie trawione markery wielkości lambda (Pharmacia) zawierające 0,5 .g bromku etydium na mililitr. Żele nanoszono na membrany nylonowe i sondowano je za pomocą następujących wewnętrznych sond reporterowych15, które znakowano końcowo fosforem -32: 5 GCTTTATCTGCCGCCATCAT3 dla EBNA-2, 5 TAGCCAGGAGAGCTCTTAAA3 dla EBNA-1 i 5 GACCTGGCTGGCCCGGACCTGACTGACTAC3 dla .. -actin. Wyniki
Rysunek 1. Rysunek 1. Wrażliwość systemu w...

Więcej »

Krwotok płucny u pacjenta z włóknistym kłębuszkowym zapaleniem nerek

FIBRILLARY kłębuszkowe zapalenie nerek jest niezwykłą chorobą nerek charakteryzującą się naciekiem mezangium i błony podstawnej kłębuszków przez złogi fibrylarne, które są negatywne w barwieniu czerwienią Kongo, ale są reaktywne w stosunku do immunoglobulin poliklonalnych.1 2 3 4 5 Uważa się, że zaburzenie jest mediowane przez lokalną wytwarzanie lub odkładanie nieprawidłowych paraprotein. 6, 7 W około 50 przypadkach tego zaburzenia, które zostały wcześniej zgłoszone, nie było przypadków płucnych lub innych objawów pozanerkowyc...

Więcej »

Krwotok płucny u pacjenta z włóknistym kłębuszkowym zapaleniem nerek ad

Ciśnienie płucno-tętnicze wynosiło 48/22 mm Hg, a ciśnienie zaklinowania w płucach i kapilarach wynosiło od 10 do 12 mm Hg. Kolejne roentgenogramy klatki piersiowej wykazały nasilenie nacieków w płucach, a hematokryt spadł do 0,26 bez śladów zewnętrznego krwawienia. Powtarzające się krwawienie rozwinęło się, a pacjentka wymagała kilku jednostek krwi podczas jej kursu w szpitalu. W pewnym momencie bronchoskopia światłowodowa ujawniła zatkanie płatka lewego lewego płata przez skrzepy krwi, ale po płukaniu oskrzeli płatek został ponown...

Więcej »

Randomizowana próba chemioterapii adiuwantowej z zastosowaniem Uracil-Tegafur do gruczolakoraka płuca czesc 4

Po drugie, w analizie rodowodu odrzucono hipotezę o ścisłym połączeniu locus określającym zwiększone nasycenie transferryny i zmniejszoną nienasyconą zdolność wiązania żelaza do haplotypu HLA. Po trzecie, histologiczny wzór depozycji żelaza wątrobowego u uczestników indeksu różni się od tego u pacjentów z hemochromatozą związaną z HLA, ponieważ żelazo w komórkach układu jednojądrzasto-fagocytowego było bardziej widoczne. Przyczyna tej różnicy w rozkładzie nadmiaru żelaza, która została opisana poprzednio, 31 jest niejasna, ...

Więcej »
http://www.gabryjaczyk.com.pl 751#grupa krwi dziedziczenie tabela , #kaszel u 8 miesięcznego dziecka , #metotreksat łuszczyca forum , #tunezja w lutym , #taniec rumba , #jak się robi echo serca , #echokardiogram , #obrzezany co to znaczy , #stanozolol cena , #uzależnienie od tramalu ,